Peptoniphilus senegalensis

On-target is the proportion of detected RI reference genomes assigned to the target; RI genome sensitivity is the proportion of target RI reference genomes detected.

Primer	Species	LP	RP	Tml	Tmr	Length	Score ⇅	On-target ⇅	RI genome sensitivity ⇅
Primer 1121	Peptoniphilus senegalensis	TGCTAATGGAGGCAAGCGA	TTTGGTCGTCAGTGCCCT	59.40	58.76	291	20	100.00% Complete 100.00%	100.00% Complete 100.00%
Primer 1122	Peptoniphilus senegalensis	ACAGCTGTTGCACTAATGGGA	AGGACATCAGAGCTCCCGT	59.93	60.00	247	12	100.00% Complete 100.00%	100.00% Complete 100.00%

Showing 1121 to 1122 (all 113 pages)