Staphylococcus xylosus

On-target is the proportion of detected RI reference genomes assigned to the target; RI genome sensitivity is the proportion of target RI reference genomes detected.

Primer	Species	LP	RP	Tml	Tmr	Length	Score ⇅	On-target ⇅	RI genome sensitivity ⇅
Primer 881	Staphylococcus xylosus	AGGTGACCAAGCACAAGGG	ACCCCATGTGCTAAGCGT	59.85	58.92	243	12	100.00% Complete 100.00%	100.00% Complete 100.00%
Primer 882	Staphylococcus xylosus	GTTCAAGTTGGCTCAAGCGA	TGCGTGGTAATCTTGCCCA	59.06	59.62	249	9	100.00% Complete 100.00%	100.00% Complete 100.00%

Showing 881 to 882 (all 89 pages)