PB PrimerBac

Dysgonomonas

Phylum:Bacteroidota Class:Bacteroidia Order:Bacteroidales Family:Dysgonomonadaceae Genus:Dysgonomonas
On-target is the proportion of detected RI reference genomes assigned to the target; RI genome sensitivity is the proportion of target RI reference genomes detected.
Primer Genus LP RP Tml Tmr Length Score ⇅ On-target ⇅ RI genome sensitivity ⇅
Primer 211 Dysgonomonas TCGTGGCGTGAAGGGTTA CGCCTCAGATGCTCATACTCA 58.54 59.66 257 14
100.00%
66.67%

Showing 211 to 211   (all 22 pages)