Mycoplasma

On-target is the proportion of detected RI reference genomes assigned to the target; RI genome sensitivity is the proportion of target RI reference genomes detected.

Primer	Genus	LP	RP	Tml	Tmr	Length	Score ⇅	On-target ⇅	RI genome sensitivity ⇅
Primer 41	Mycoplasma	GCGGTGAAGCTTTAAAAGGTG	TCCATTCCAATGTTTTCGCCT	58.34	58.48	163	33	100.00% Complete 100.00%	66.67% Complete 66.67%
Primer 42	Mycoplasma	TGTTGCAAGTAATGGTGCTCA	GCCCATAACTTGATGAGCTCA	58.42	58.08	205	32	100.00% Complete 100.00%	66.67% Complete 66.67%

Showing 41 to 42 (all 5 pages)