Brachyspira

On-target is the proportion of detected RI reference genomes assigned to the target; RI genome sensitivity is the proportion of target RI reference genomes detected.

Primer	Genus	LP	RP	Tml	Tmr	Length	Score ⇅	On-target ⇅	RI genome sensitivity ⇅
Primer 871	Brachyspira	AGCAGCAAACAAAGGCGA	ACTGCATGAAGGCATTCCCA	58.16	59.96	196	9	100.00% Complete 100.00%	75.00% Complete 75.00%

Showing 871 to 871 (all 88 pages)